Python Channel

I'm very new to python and please treat me as same. When i tried to convert the XML content int… Read more Convert Nested Xml Content Into Csv Using Xml Tree In Python

I am trying to write a simple program in python to use telegram api, (not bot api, main messaging a… Read more Telegram Api - Creating An Authorization Key 404 Error

I've searched all over, but have yet to find a simple example showing how to change a minor ele… Read more Changing Ttk Widget Text Color

I have an object defined as follows class a(): @property def prop(self): print('… Read more Can Python Objects Have Nested Properties?

I have a camera pointing at a Zen Garden from above. However, the camera is fixed on the side rathe… Read more Opencv - Adjusting Photo With Skew Angle (tilt)

Below are the two different attempts I have made in trying to achieve a multi-column unique constra… Read more Sqlalchemy Not Producing Proper Sql Statement For Multi Column Uniqueconstraints

I´m trying to do the simplest thing, open a file, read and close it in python. Simple. Well this is… Read more How To Open A Text File That Has Emojis In It?

I am working to quantize my existing inception model graph in an attempt to reduce its size from ~8… Read more Tensorflow: Quantization Error "analysis Of Target '//tensorflow/tools/graph_transforms:transform_graph' Failed; Build Aborted."

I am an absolute newbie. I'm trying to make Python GUI for my school project so I decided to us… Read more Running Tkinter On Mac

Is there a a better way to remove the last N elements of a list. for i in range(0,n): lst.pop( … Read more Remove The Last N Elements Of A List

I have the the sample stored in the following list sample = [AAAA,CGCG,TTTT,AT-T,CATC] .. To illu… Read more How To Calculate Frequency Of Elements For Pairwise Comparisons Of Lists In Python?

from a string say dna = 'ATAGGGATAGGGAGAGAGCGATCGAGCTAG' i got substring say dna.format = &… Read more How To Select Only Certain Substrings

I have a pyspark dataframe with two columns: [Row(zip_code='58542', dma='MIN'), Ro… Read more Pyspark Create Dictionary From Data In Two Columns

I'm attempting to import data (tweets and other twitter text information) into a database using… Read more Pymysql Warning: (1366, "incorrect String Value: '\\xf0\\x9f\\x98\\x8d T...')

I need help setting up Tor in Ubuntu and to use it within scrapy framework. I did some research and… Read more Using Tor Proxy With Scrapy

In the same experiment, I tried to positionize a Label using this code: class TetraApp(App): d… Read more Position Of The Kivy Label

I'm learning Learn Python the hard way. w = 'This is the left side of...' e = 'a st… Read more Why Does + (plus) Can Concatenate Two Strings In Python?

I want solve differential equation using sympy on Python3. My equation is relatively simple with tw… Read more Error Using 'exp' In Sympy -typeerror And Attribute Error Is Displayed

When considering the problem of classifying an input to one of 2 classes, 99% of the examples I saw… Read more Binary Cross Entropy Vs Categorical Cross Entropy With 2 Classes

What is the best way to figure out how two dataframes differ based on a combination of multiple col… Read more Compare Pandas Dataframes By Multiple Columns